ID: 1051272091_1051272107

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1051272091 1051272107
Species Human (GRCh38) Human (GRCh38)
Location 9:15365531-15365553 9:15365579-15365601
Sequence CCCAGCCAGCTTCACCTCAGACA GTGGATCACCTGAGGTCGGGGGG
Strand - +
Off-target summary No data {0: 37, 1: 375, 2: 637, 3: 1151, 4: 5055}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!