ID: 1051272093_1051272100

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1051272093 1051272100
Species Human (GRCh38) Human (GRCh38)
Location 9:15365536-15365558 9:15365560-15365582
Sequence CCAGCTTCACCTCAGACACCAGC CTTTGGGAGGCCGATGCAGGTGG
Strand - +
Off-target summary No data {0: 143, 1: 28815, 2: 120336, 3: 164052, 4: 163387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!