ID: 1051272096_1051272105

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1051272096 1051272105
Species Human (GRCh38) Human (GRCh38)
Location 9:15365545-15365567 9:15365577-15365599
Sequence CCTCAGACACCAGCACTTTGGGA AGGTGGATCACCTGAGGTCGGGG
Strand - +
Off-target summary No data {0: 41, 1: 438, 2: 1613, 3: 2302, 4: 3378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!