ID: 1051274208_1051274211

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1051274208 1051274211
Species Human (GRCh38) Human (GRCh38)
Location 9:15383436-15383458 9:15383471-15383493
Sequence CCTCAAGTTAAGGGCTATGAGAG ACTTGAGGAAATAAGCAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!