ID: 1051292602_1051292610

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1051292602 1051292610
Species Human (GRCh38) Human (GRCh38)
Location 9:15560272-15560294 9:15560311-15560333
Sequence CCTGCCTCACTAGGTTGGGGAAG CCTGAAGGGTGTTTTCCACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 14, 3: 63, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!