ID: 1051292603_1051292605

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1051292603 1051292605
Species Human (GRCh38) Human (GRCh38)
Location 9:15560276-15560298 9:15560296-15560318
Sequence CCTCACTAGGTTGGGGAAGCTCT TCTCCTGGATGATATCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 97, 3: 1551, 4: 5039} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!