ID: 1051394189_1051394193

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1051394189 1051394193
Species Human (GRCh38) Human (GRCh38)
Location 9:16601598-16601620 9:16601614-16601636
Sequence CCTACTACACACTCCTGAGCCTG GAGCCTGAAAATGATGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 36, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!