ID: 1051512671_1051512679

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1051512671 1051512679
Species Human (GRCh38) Human (GRCh38)
Location 9:17896486-17896508 9:17896520-17896542
Sequence CCTGTATGTTTGCTCACAAATTT TTGTGGAAGGGGACGGAAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!