ID: 1051569089_1051569091

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1051569089 1051569091
Species Human (GRCh38) Human (GRCh38)
Location 9:18535343-18535365 9:18535370-18535392
Sequence CCTGTATCACTATCAGCATTTTG AAGCCATTCAACAAGACTGTAGG
Strand - +
Off-target summary {0: 4, 1: 46, 2: 86, 3: 86, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!