ID: 1051602507_1051602514

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1051602507 1051602514
Species Human (GRCh38) Human (GRCh38)
Location 9:18889475-18889497 9:18889498-18889520
Sequence CCTGTCACCTTCTCCCTGCCCTG CTCAGAAGGAATTCAGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 80, 4: 673} {0: 1, 1: 0, 2: 1, 3: 24, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!