ID: 1051603472_1051603481

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1051603472 1051603481
Species Human (GRCh38) Human (GRCh38)
Location 9:18897191-18897213 9:18897226-18897248
Sequence CCTGGGTTATACTAACAGATGTC GGGACAGAGCCCCCGGGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 17, 2: 569, 3: 798, 4: 1177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!