ID: 1051629239_1051629256

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1051629239 1051629256
Species Human (GRCh38) Human (GRCh38)
Location 9:19127338-19127360 9:19127364-19127386
Sequence CCGGGGAGCCCCCCACCCCAACT CGCCGCTGGGGGCCCGGGACCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 60, 4: 469} {0: 1, 1: 0, 2: 1, 3: 23, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!