ID: 1051671507_1051671517

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1051671507 1051671517
Species Human (GRCh38) Human (GRCh38)
Location 9:19515327-19515349 9:19515351-19515373
Sequence CCTAAGTACCCTGAGTTTCTTGG CAGGGTACTCTGGTGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 211} {0: 1, 1: 0, 2: 0, 3: 18, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!