ID: 1051721608_1051721613

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1051721608 1051721613
Species Human (GRCh38) Human (GRCh38)
Location 9:20042886-20042908 9:20042926-20042948
Sequence CCACAAGCCATGCCCATGTAAGA AAATGTTATGTGTATTTTAATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 52, 3: 118, 4: 367} {0: 1, 1: 0, 2: 5, 3: 100, 4: 771}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!