ID: 1051822281_1051822289

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1051822281 1051822289
Species Human (GRCh38) Human (GRCh38)
Location 9:21181754-21181776 9:21181784-21181806
Sequence CCAGGCAGGGAACCCCTGTCTTG AGCACAGACACCCCCATTCCAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 23, 3: 59, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!