ID: 1051824813_1051824818

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1051824813 1051824818
Species Human (GRCh38) Human (GRCh38)
Location 9:21209405-21209427 9:21209435-21209457
Sequence CCTGCCCTAAGCAAGACTCCAGG GCTGCTGATGAAATCCAGTGTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 3, 3: 19, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!