ID: 1051840830_1051840835

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1051840830 1051840835
Species Human (GRCh38) Human (GRCh38)
Location 9:21396191-21396213 9:21396204-21396226
Sequence CCCTAATCCCCAAGCGCCCGGGC GCGCCCGGGCCTCCACTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60} {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!