ID: 1051877252_1051877258

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1051877252 1051877258
Species Human (GRCh38) Human (GRCh38)
Location 9:21805688-21805710 9:21805717-21805739
Sequence CCTTATTCCCTCTACTAAGTGAG CCATCTATGAGCCAAAACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!