ID: 1051880823_1051880831

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1051880823 1051880831
Species Human (GRCh38) Human (GRCh38)
Location 9:21838036-21838058 9:21838076-21838098
Sequence CCAGAATAAATCATGTGGGCTTG TGGTTAATTGGCAGAGCGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145} {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!