ID: 1051912521_1051912525

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1051912521 1051912525
Species Human (GRCh38) Human (GRCh38)
Location 9:22170689-22170711 9:22170721-22170743
Sequence CCTAATTAGTCATAGGCACCAAG AAGTTCCCCCAAAGTGATCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!