ID: 1051936234_1051936245

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1051936234 1051936245
Species Human (GRCh38) Human (GRCh38)
Location 9:22446697-22446719 9:22446721-22446743
Sequence CCCTCCTCCCAGAAGGTCCCCAC CCCCGCCCCGGGCCCTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 404} {0: 1, 1: 2, 2: 20, 3: 213, 4: 1347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!