ID: 1052105886_1052105889

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1052105886 1052105889
Species Human (GRCh38) Human (GRCh38)
Location 9:24515383-24515405 9:24515403-24515425
Sequence CCCCTTTGAGTGAATTAGTACTC CTCCTATAGCATTACCTGTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!