ID: 1052116022_1052116025

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1052116022 1052116025
Species Human (GRCh38) Human (GRCh38)
Location 9:24649213-24649235 9:24649233-24649255
Sequence CCATAAATACCCTTGACTCAGCC GCCAGACTCACACAGACATCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 87, 3: 260, 4: 581} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!