ID: 1052125114_1052125121

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1052125114 1052125121
Species Human (GRCh38) Human (GRCh38)
Location 9:24765157-24765179 9:24765180-24765202
Sequence CCCTGCCCAGTTTGAACTTCCTG GTGGCTTTGTTTACACTGTGAGG
Strand - +
Off-target summary No data {0: 250, 1: 389, 2: 453, 3: 265, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!