ID: 1052137355_1052137361

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1052137355 1052137361
Species Human (GRCh38) Human (GRCh38)
Location 9:24929558-24929580 9:24929607-24929629
Sequence CCTCTAGTTTTGCTTGTACTATT TGGGTATGTATGTATGTGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 112, 4: 1251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!