ID: 1052144989_1052144992

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1052144989 1052144992
Species Human (GRCh38) Human (GRCh38)
Location 9:25037515-25037537 9:25037543-25037565
Sequence CCTATGCCATCTTGTCTGGGCTG TTGTGTTTGTTTTTTTTAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 37, 3: 577, 4: 6101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!