ID: 1052274339_1052274345

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1052274339 1052274345
Species Human (GRCh38) Human (GRCh38)
Location 9:26660734-26660756 9:26660755-26660777
Sequence CCCCCACAACACTGTAAATCGCC CCAGGACTCAGAAAAATATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 90} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!