ID: 1052283232_1052283239

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1052283232 1052283239
Species Human (GRCh38) Human (GRCh38)
Location 9:26756193-26756215 9:26756226-26756248
Sequence CCTGCACCCACTGGAGGGAATGA CTCACATGGAGGAAGGTGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 28, 2: 109, 3: 461, 4: 1540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!