ID: 1052340403_1052340413

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1052340403 1052340413
Species Human (GRCh38) Human (GRCh38)
Location 9:27359345-27359367 9:27359366-27359388
Sequence CCCGTCACAGGAGTCATAGGGAG AGTGTGTGTGTGTGGGGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94} {0: 9, 1: 209, 2: 981, 3: 3338, 4: 13407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!