ID: 1052358623_1052358626

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1052358623 1052358626
Species Human (GRCh38) Human (GRCh38)
Location 9:27529853-27529875 9:27529872-27529894
Sequence CCTGCGGTATGGCAGCACCGTGG GTGGAGAGAAAAGTCGTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 1, 2: 1, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!