ID: 1052365612_1052365619

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1052365612 1052365619
Species Human (GRCh38) Human (GRCh38)
Location 9:27608965-27608987 9:27608994-27609016
Sequence CCTGGTGGAAGAAACATCATCCT CTGTTCCCATGGAGGTGACAGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 6, 3: 16, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!