ID: 1052378230_1052378233

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1052378230 1052378233
Species Human (GRCh38) Human (GRCh38)
Location 9:27741704-27741726 9:27741722-27741744
Sequence CCATGTAACAGTCTGGCCACTTT ACTTTTCTGTAGGACTGCTGTGG
Strand - +
Off-target summary {0: 14, 1: 37, 2: 50, 3: 80, 4: 730} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!