ID: 1052384543_1052384551

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1052384543 1052384551
Species Human (GRCh38) Human (GRCh38)
Location 9:27808044-27808066 9:27808093-27808115
Sequence CCTTAGTAATATCTTTGAGATTG AGTTTTTAAGAGCTGGAGTAGGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 13, 3: 40, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!