ID: 1052395144_1052395154

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1052395144 1052395154
Species Human (GRCh38) Human (GRCh38)
Location 9:27929488-27929510 9:27929504-27929526
Sequence CCTCTTCCTTTTACCTGGGTGGG GGGTGGGGGTGGAGGGAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 98, 3: 781, 4: 5365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!