ID: 1052414109_1052414111

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1052414109 1052414111
Species Human (GRCh38) Human (GRCh38)
Location 9:28156281-28156303 9:28156314-28156336
Sequence CCTTTCAACAGAAATGTGACATA AGTAACCCCATTCTAAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!