ID: 1052487813_1052487817

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1052487813 1052487817
Species Human (GRCh38) Human (GRCh38)
Location 9:29125323-29125345 9:29125356-29125378
Sequence CCTAGATGACGTGTTGATAGGTG CCATGGCACATATATACCTATGG
Strand - +
Off-target summary No data {0: 1, 1: 30, 2: 76, 3: 112, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!