ID: 1052546655_1052546665

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1052546655 1052546665
Species Human (GRCh38) Human (GRCh38)
Location 9:29889009-29889031 9:29889051-29889073
Sequence CCTGACCCATCCTTCTTCACTGG AGTCCAATAACTCCATTTAGAGG
Strand - +
Off-target summary {0: 2, 1: 26, 2: 138, 3: 161, 4: 455} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!