ID: 1052710989_1052710992

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1052710989 1052710992
Species Human (GRCh38) Human (GRCh38)
Location 9:32055225-32055247 9:32055264-32055286
Sequence CCTAAAATTCTGCTTTTTACAAT TATTTTCTATGGCTCATGCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!