ID: 1052747117_1052747118

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1052747117 1052747118
Species Human (GRCh38) Human (GRCh38)
Location 9:32451733-32451755 9:32451765-32451787
Sequence CCTGGGGATCTTATTTATATTCA TAAATTACAAACAAACAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 397} {0: 1, 1: 0, 2: 8, 3: 234, 4: 5921}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!