ID: 1052762956_1052762958

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1052762956 1052762958
Species Human (GRCh38) Human (GRCh38)
Location 9:32611298-32611320 9:32611323-32611345
Sequence CCCTGTGGGAACAGGTATTTGGT CAGCTAGAATTCACATGCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!