ID: 1052774218_1052774225

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1052774218 1052774225
Species Human (GRCh38) Human (GRCh38)
Location 9:32717677-32717699 9:32717711-32717733
Sequence CCAACGCCCCTTCCTTCATATCA CTTCTACTATTCAGAAAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 30, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!