ID: 1052813998_1052814011

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1052813998 1052814011
Species Human (GRCh38) Human (GRCh38)
Location 9:33085713-33085735 9:33085766-33085788
Sequence CCTAATACTATACTTTTCCAATG ATCCCGCGCGTGGCTCGGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 10, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!