ID: 1052904031_1052904040

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1052904031 1052904040
Species Human (GRCh38) Human (GRCh38)
Location 9:33817909-33817931 9:33817948-33817970
Sequence CCCTCTACGAAGGCGGCTACTTC CCTCCCGGACCCTGCTTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 30} {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!