ID: 1052917232_1052917238

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1052917232 1052917238
Species Human (GRCh38) Human (GRCh38)
Location 9:33932754-33932776 9:33932771-33932793
Sequence CCATCCTCATTCCTTATCCCCAC CCCCACAGAGCCCAGTGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 642} {0: 1, 1: 1, 2: 3, 3: 29, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!