ID: 1052936808_1052936817

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1052936808 1052936817
Species Human (GRCh38) Human (GRCh38)
Location 9:34100017-34100039 9:34100047-34100069
Sequence CCTTGGACCCCCTTATGTCTCTC AGAGACAGGGTCTCACTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!