ID: 1052972070_1052972077

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1052972070 1052972077
Species Human (GRCh38) Human (GRCh38)
Location 9:34382662-34382684 9:34382684-34382706
Sequence CCTAATGGTGAAATATCAGTCAC CTGTAGTTTGGGAGGTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143} {0: 1, 1: 1, 2: 3, 3: 31, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!