ID: 1052981517_1052981522

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1052981517 1052981522
Species Human (GRCh38) Human (GRCh38)
Location 9:34453381-34453403 9:34453422-34453444
Sequence CCTTCCCAAGCTCATGTAGTCAG CCTCACCCTCTCCCAAAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 44, 4: 506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!