ID: 1053001630_1053001637

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1053001630 1053001637
Species Human (GRCh38) Human (GRCh38)
Location 9:34579942-34579964 9:34579968-34579990
Sequence CCCTGCTCGCTGAGGCAATCCTC GATCCCCAGGAAGAGGGTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!