ID: 1053006879_1053006886

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1053006879 1053006886
Species Human (GRCh38) Human (GRCh38)
Location 9:34610845-34610867 9:34610869-34610891
Sequence CCACAGCTGGAGCTGGGCATGGA CCCAGGCCAGGGGGTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 441} {0: 1, 1: 0, 2: 6, 3: 53, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!