ID: 1053010260_1053010267

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1053010260 1053010267
Species Human (GRCh38) Human (GRCh38)
Location 9:34628900-34628922 9:34628921-34628943
Sequence CCCGCGGCCGCACTCACCTGCCT CTGGCGTGGCCCGCTGCCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 38, 4: 1197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!